| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.252718 |
| Chromosome: | chromosome 4 |
| Location: | 2423887 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g221350 | (1 of 19) IPR003034 - SAP domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGGGGTCGACGCGGCTACAAGAGGCTC |
| Internal bar code: | TGGGGCGCCCACCACACCAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 263 |
| LEAP-Seq percent confirming: | 26.1517 |
| LEAP-Seq n confirming: | 1896 |
| LEAP-Seq n nonconfirming: | 5354 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGGGTCGAAGAAGGAAAA |
| Suggested primer 2: | CTGCTGCTGACAGCTACTGC |