| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.252760 |
| Chromosome: | chromosome 12 |
| Location: | 2183033 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g508550 | PANB,PAN2,PANB1 | (1 of 1) 2.1.2.11 - 3-methyl-2-oxobutanoate hydroxymethyltransferase / Ketopantoate hydroxymethyltransferase; Ketopantoate hydroxymethyltransferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGTCCGCCAGTCCTCCTTGTTTGCGTT |
| Internal bar code: | CCGGTGGCAAAGGCCAAATCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 592 |
| LEAP-Seq percent confirming: | 95.942 |
| LEAP-Seq n confirming: | 993 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTGCTACTGCCGACAAG |
| Suggested primer 2: | TGAGTGCTTGACCAGAATGC |