| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.252804 |
| Chromosome: | chromosome 2 |
| Location: | 1704346 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086000 | ARS8 | Arylsulfatase; (1 of 1) IPR002591//IPR003882//IPR017850 - Type I phosphodiesterase/nucleotide pyrophosphatase/phosphate transferase // Pistil-specific extensin-like protein // Alkaline-phosphatase-like, core domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTAAGCAATCGGTCTTGCTTATGTCTTG |
| Internal bar code: | TCCCCAAGCCCGTAGCTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 580 |
| LEAP-Seq percent confirming: | 97.7979 |
| LEAP-Seq n confirming: | 8660 |
| LEAP-Seq n nonconfirming: | 195 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACTCCCTGGGCACTATTC |
| Suggested primer 2: | ACTGTCCTGCCTACCCACAC |