| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.252825 |
| Chromosome: | scaffold 19 |
| Location: | 203859 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g751247 | (1 of 1) K16742 - ADP-ribosylation factor-like protein 2-binding protein (ARL2BP, BART) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAAGCGCAAGCAAAGCGCAAGCTCTACA |
| Internal bar code: | CTCAGCCCAGAAGGGGATGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 359 |
| LEAP-Seq percent confirming: | 99.8188 |
| LEAP-Seq n confirming: | 551 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCCATGTAGGGTCTTTTC |
| Suggested primer 2: | GTGGCTTGAGGCGTGTTTAT |