| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.252843 |
| Chromosome: | chromosome 14 |
| Location: | 226404 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609202 | Conserved Protein With Tyrosinase Domain; (1 of 1) 3.4.24.7 - Interstitial collagenase / Vertebrate collagenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTTCGGGGATGGGGACTACTATCGCTCC |
| Internal bar code: | TAGGCGTTGGGAAGGCGCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 27.2727 |
| LEAP-Seq n confirming: | 105 |
| LEAP-Seq n nonconfirming: | 280 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCATCAACACTCACGCACA |
| Suggested primer 2: | COULD_NOT_FIND_PRIMER |