Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.252905 |
Chromosome: | chromosome 3 |
Location: | 3840417 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g170650 | (1 of 1) IPR001849//IPR011993 - Pleckstrin homology domain // Pleckstrin-homology domain (PH domain)/Phosphotyrosine-binding domain (PTB) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCATCTTGCTACTCCTCCTCTTCCCCCT |
Internal bar code: | GGGCAGGGGTCGTACGGGCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 69 |
LEAP-Seq percent confirming: | 99.337 |
LEAP-Seq n confirming: | 899 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGCCTTAGTAATGAGCCG |
Suggested primer 2: | AATCGTTCCCTTGCTTTCCT |