| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.252911 |
| Chromosome: | chromosome 2 |
| Location: | 2732727 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093700 | (1 of 1) K14951 - cation-transporting ATPase 13A3/4/5 (ATP13A3_4_5) | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACAAGGCTGCTTTGGCGGACTGCATTT |
| Internal bar code: | GATTTGTGTTATTAACTCAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1057 |
| LEAP-Seq percent confirming: | 99.6567 |
| LEAP-Seq n confirming: | 4645 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGAAGTCCAGGTCAGCTC |
| Suggested primer 2: | GGCTTGGCTAGGACTCACTG |