Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.252914 |
Chromosome: | chromosome 17 |
Location: | 181137 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g697406 | (1 of 45) IPR029052 - Metallo-dependent phosphatase-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAAAGCGTCGGCGCCTCCATATGCCGCC |
Internal bar code: | CTTGGGTAGTCCCTTGTCAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 563 |
LEAP-Seq percent confirming: | 98.2293 |
LEAP-Seq n confirming: | 1165 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTCGCAGGATGATGTGAC |
Suggested primer 2: | GGAGCTCAAGCAGGGTGTAG |