| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.253008 |
| Chromosome: | chromosome 6 |
| Location: | 1526320 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g259900 | ATPC1,ATPC | Chloroplast ATP synthase gamma chain; (1 of 1) K02115 - F-type H+-transporting ATPase subunit gamma (ATPF1G, atpG) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCTCTTGGGCTCGGTGTGTGGGCTTGT |
| Internal bar code: | GTGGCGAACGGGACGACCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 582 |
| LEAP-Seq percent confirming: | 92.4516 |
| LEAP-Seq n confirming: | 1433 |
| LEAP-Seq n nonconfirming: | 117 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAAGCTGTCAGTTGGAGCC |
| Suggested primer 2: | TCTGCAACAGATCCTGAACG |