| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.253084 |
| Chromosome: | chromosome 2 |
| Location: | 5436215 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107550 | CVL2 | Fe2+/Mn2+ transporter, VIT1/CCC1 family; (1 of 2) PF01988 - VIT family (VIT1) | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCTCAAGGCGGCGGCCTATATTAGTGCA |
| Internal bar code: | TCGGGGGAGTTACCGTGCCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 126 |
| LEAP-Seq percent confirming: | 95.4128 |
| LEAP-Seq n confirming: | 208 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTTGAAGCCACATCAGA |
| Suggested primer 2: | GTTTGGAATGCGTTTGAGGT |