Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.253096 |
Chromosome: | chromosome 1 |
Location: | 2949010 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g018000 | RPA12 | DNA-directed RNA polymerase I subunit A12.2; (1 of 1) K03000 - DNA-directed RNA polymerase I subunit RPA12 (RPA12, ZNRD1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTCACAACCGTCAGCATGGTACTACG |
Internal bar code: | ATCCAAGCAAACAACCCTGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 597 |
LEAP-Seq percent confirming: | 99.0164 |
LEAP-Seq n confirming: | 302 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGACCGTCTTCTACGAG |
Suggested primer 2: | GTGGAGAATCGGTCACAGGT |