Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.253138 |
Chromosome: | chromosome 12 |
Location: | 5743266 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g533000 | PHR2,PHR1 | (1 of 3) K01669 - deoxyribodipyrimidine photo-lyase [EC:4.1.99.3] (phrB); CPD photolyase, class II | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCCACTACTGCCCCACATACGACAGCC |
Internal bar code: | CCAATATACGAGGGGTACGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 667 |
LEAP-Seq percent confirming: | 79.4118 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTATGTGGATGTTGGAGG |
Suggested primer 2: | CTATACACAACCGCTTCCCC |