| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.253152 |
| Chromosome: | chromosome 13 |
| Location: | 3900911 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590500 | FAD6,DES6 | (1 of 1) K10255 - omega-6 fatty acid desaturase (delta-12 desaturase) (FAD6, desA); Omega-6-fatty acid desaturase, chloroplast isoform | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACAAAGTAGCGCAACTGCTGCACTGCT |
| Internal bar code: | CCCGCTTTAATGGCTCGTCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 478 |
| LEAP-Seq percent confirming: | 97.3171 |
| LEAP-Seq n confirming: | 399 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTCCTCTCTCTTGTCACC |
| Suggested primer 2: | TGTGTGTGCTCGTGACAAAA |