Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.253169 |
Chromosome: | chromosome 7 |
Location: | 504782 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g316050 | CDJ2 | Chloroplast DnaJ-like protein 2; (1 of 4) K03686 - molecular chaperone DnaJ (dnaJ) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACACAGGAGTTCCTGGACTTCCTAGAG |
Internal bar code: | ACTACGGCGTGTGACCCGAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 446 |
LEAP-Seq percent confirming: | 98.6513 |
LEAP-Seq n confirming: | 512 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCGTCAACAAAAGCCATC |
Suggested primer 2: | TAACGCTTCAATGGAGGGAC |