| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.253177 |
| Chromosome: | chromosome 6 |
| Location: | 8500200 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307800 | CYN49 | (1 of 1) IPR003609//IPR029000 - PAN/Apple domain // Cyclophilin-like domain; Cyclophilin 49 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATCAGCGGTGGCCGTGGGGAGTGCTTT |
| Internal bar code: | GACATGGTGTACTCGAAGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 339 |
| LEAP-Seq percent confirming: | 99.7817 |
| LEAP-Seq n confirming: | 457 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTTGGCATACAGGGCATC |
| Suggested primer 2: | ATCGTTCTCAATTTGTCCGC |