| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.253349 |
| Chromosome: | chromosome 8 |
| Location: | 1764763 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g366200 | (1 of 1) K17983 - sensitive to high expression protein 9, mitochondrial (SHE9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCACTGCTGCTGCTGCTGCTGCTGCTAC |
| Internal bar code: | GTGGTTCTGGGGACAATACAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 488 |
| LEAP-Seq percent confirming: | 60.7338 |
| LEAP-Seq n confirming: | 1109 |
| LEAP-Seq n nonconfirming: | 717 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACAGCACACACCCTATG |
| Suggested primer 2: | TCCACATGATACAGGCTCCA |