| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.253452 |
| Chromosome: | chromosome 5 |
| Location: | 3464586 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241450 | FTSY1,FTSY | (1 of 1) K03110 - fused signal recognition particle receptor (ftsY); Chloroplast SRP Receptor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGGGCACTGTAAATGCAACTGGTGCAT |
| Internal bar code: | CTCCACAGTTACGTATGCGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 518 |
| LEAP-Seq percent confirming: | 98.674 |
| LEAP-Seq n confirming: | 1265 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTCCTACGGTATGTGTT |
| Suggested primer 2: | CCCTACTTGTGCTAGACGGC |