| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.253489 |
| Chromosome: | chromosome 13 |
| Location: | 4607093 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g604050 | (1 of 1) IPR002048//IPR006626//IPR011050 - EF-hand domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCGTCTTTGGCGTTTTGTGTCTCTCGG |
| Internal bar code: | CGGTCACAGGCATGGACAAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 219 |
| LEAP-Seq percent confirming: | 98.9053 |
| LEAP-Seq n confirming: | 6776 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCGCGTACAGGTATGGAC |
| Suggested primer 2: | GTTAGCTCCCCTCTCCAACC |