| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.253537 |
| Chromosome: | chromosome 7 |
| Location: | 832081 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318500 | CYA8 | Putative very-long-chain fatty acid condensing enzyme; (1 of 5) 2.3.1.199 - Very-long-chain 3-oxoacyl-CoA synthase / Very-long-chain beta-ketoacyl-CoA synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAACCCAACAGCCGCCAGCCACAGCCGCC |
| Internal bar code: | TAAACGCTCTATGCTTCCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1121 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGAAGCAAGGAACAAAGC |
| Suggested primer 2: | ATGATGGCGTGTATGTCGAA |