| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.253569 |
| Chromosome: | chromosome 2 |
| Location: | 6397697 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115508 | (1 of 1) IPR001611//IPR003590//IPR003591 - Leucine-rich repeat // Leucine-rich repeat, ribonuclease inhibitor subtype // Leucine-rich repeat, typical subtype | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGCCATGTTATTGCCCTCCCGAATCCC |
| Internal bar code: | TTGCGGCTCGCTGTCCCGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 523 |
| LEAP-Seq percent confirming: | 99.6016 |
| LEAP-Seq n confirming: | 500 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGCACCATCCTCATAGA |
| Suggested primer 2: | GGGTACGTGTTGTGCAACTG |