Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.253797 |
Chromosome: | chromosome 17 |
Location: | 1147009 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g704300 | FAP47 | Flagellar Associated Protein 47; (1 of 1) PTHR23053//PTHR23053:SF2 - DLEC1 DELETED IN LUNG AND ESOPHAGEAL CANCER 1 // PRIMARY CILIARY DYSKINESIA PROTEIN 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTTGATGGCGGGTGCGTGTTTAAGGTC |
Internal bar code: | AAAGGACGGCGGTTGCGAACAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 472 |
LEAP-Seq percent confirming: | 83.2504 |
LEAP-Seq n confirming: | 502 |
LEAP-Seq n nonconfirming: | 101 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAACACGCTTCTCTTGCCC |
Suggested primer 2: | CTTAGGTGGTTGCAGGAAGC |