| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.253805 |
| Chromosome: | chromosome 8 |
| Location: | 1222589 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363250 | (1 of 3) IPR000104//IPR006553 - Antifreeze protein, type I // Leucine-rich repeat, cysteine-containing subtype | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGCTGGATGCGTCTGGCGAAGAGGTGT |
| Internal bar code: | TCCTGCTTTAAGGCCGTCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 335 |
| LEAP-Seq percent confirming: | 99.1453 |
| LEAP-Seq n confirming: | 348 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCCTCACCTAGTGCTCTT |
| Suggested primer 2: | CAGAGACACGCACAGTGACA |