| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.253946 |
| Chromosome: | chromosome 14 |
| Location: | 1165355 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g615750 | CAM2,CAM2b | Calmodulin-like protein; (1 of 38) IPR002048//IPR011992 - EF-hand domain // EF-hand domain pair | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGTGTTGCGCCTAGCCTCGTAGGTCCT |
| Internal bar code: | ACGTAGTCAAGGATGCACGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 99.1981 |
| LEAP-Seq n confirming: | 1237 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGTGTCTGCTATCCACTA |
| Suggested primer 2: | CTGTCGGTATGGTTGGCTTT |