| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.253988 |
| Chromosome: | chromosome 2 |
| Location: | 4184271 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098450 | EIF2G | (1 of 1) K03242 - translation initiation factor 2 subunit 3 (EIF2S3); eIF2 gamma subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCAACAGTTCTACACTTCTACCGCTCC |
| Internal bar code: | CGGCCCCGACATGGTAAGCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 944 |
| LEAP-Seq percent confirming: | 99.4483 |
| LEAP-Seq n confirming: | 2163 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGCACATATTCATGCCG |
| Suggested primer 2: | CAGGTGACCAAGATGAGCAA |