| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.254059 |
| Chromosome: | chromosome 17 |
| Location: | 1424445 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g706650 | VPS22 | Subunit of ESCRT-II complex; (1 of 1) K12188 - ESCRT-II complex subunit VPS22 (SNF8, EAP30) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCAGTCAGCCTGCCGCTTCACCCAATCC |
| Internal bar code: | TAAGGAAGACCATGTTACTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 377 |
| LEAP-Seq percent confirming: | 97.5 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTTTCAGGAAAAGCGGTG |
| Suggested primer 2: | CGCCACCTTGTATTGTTCCT |