Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.254203 |
Chromosome: | chromosome 13 |
Location: | 3741370 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589450 | FBB6L1 | (1 of 1) IPR002035//IPR013694 - von Willebrand factor, type A // VIT domain; FBB6 like protein 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGGCGCAGCTGCCCGCGTGCTTTTTCG |
Internal bar code: | GCTGCTTGTAGGCCGTTACCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 134 |
LEAP-Seq percent confirming: | 89.2857 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACATGCCTGGTTGTAAGCC |
Suggested primer 2: | GAGGTAGCTGAACTCCACCG |