| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.254205 |
| Chromosome: | chromosome 14 |
| Location: | 1793895 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g619900 | PHX22,PFH22 | Putative prolyl 4-hydroxylase; (1 of 1) PTHR10869:SF80 - IRON ION BINDING / OXIDOREDUCTASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATGGCGGGCGACATGACGTACAGGAAAG |
| Internal bar code: | ACGGGATCGGAACGGAGGAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 368 |
| LEAP-Seq percent confirming: | 94.7072 |
| LEAP-Seq n confirming: | 841 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTAAATGACGTTCGGGT |
| Suggested primer 2: | CCAGCCCAAACTAAAACCAA |