Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.254362 |
Chromosome: | chromosome 11 |
Location: | 2659103 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g476600 | (1 of 5) IPR006094//IPR016166 - FAD linked oxidase, N-terminal // FAD-binding, type 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGATGCGTGCCCGAGTCCGGAGCTATCAA |
Internal bar code: | TTTCTACGCTCGTTTGTGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 291 |
LEAP-Seq percent confirming: | 99.4509 |
LEAP-Seq n confirming: | 5796 |
LEAP-Seq n nonconfirming: | 32 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAACGGTCCCCCGTACATA |
Suggested primer 2: | GCGCAACAGAAAGAATGACA |