| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.254456 |
| Chromosome: | chromosome 6 |
| Location: | 6372435 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g292150 | (1 of 2) PF13499//PF13833 - EF-hand domain pair (EF-hand_7) // EF-hand domain pair (EF-hand_8) | 3'UTR|outside_mRNA | |
| Cre06.g292183 | CAM13 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGCGCAGGGGTTGCTGATGTCGAAAAA |
| Internal bar code: | CGATTGGCGGTGGGGAGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 150 |
| LEAP-Seq percent confirming: | 76.1905 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGCCGGTATGTTCATCTG |
| Suggested primer 2: | GGTTTTGGGACTGCACTGTT |