| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.254468 |
| Chromosome: | chromosome 2 |
| Location: | 5120834 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105026 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCGCTGCAGCTTGGTCGGCTGCTCGAAG |
| Internal bar code: | TGTGAAGACCAAAGGAGAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 99.631 |
| LEAP-Seq n confirming: | 270 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGGCAAAAACGAAGAAG |
| Suggested primer 2: | TACAAGACCTCCAAGGTGGG |