Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.254510 |
Chromosome: | chromosome 1 |
Location: | 4334243 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g029350 | C1d-87,FAP297 | Flagellar central pair-associated protein 297; (1 of 1) IPR006885//IPR017986 - NADH dehydrogenase ubiquinone Fe-S protein 4, mitochondrial // WD40-repeat-containing domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTCCACCTCGCTAGCTGGGCTGACAGC |
Internal bar code: | TCAGGTTCGCTTTATCATAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 492 |
LEAP-Seq percent confirming: | 99.5953 |
LEAP-Seq n confirming: | 5414 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGGAAGAAATGCAGGCAG |
Suggested primer 2: | TGTGGAAGGACAGTTAGGGG |