Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.254565 |
Chromosome: | chromosome 11 |
Location: | 2413893 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g475000 | IFT121,IFT122B,FAP118 | Intraflagellar Transport Protein 121; (1 of 1) PTHR16517:SF1 - WD REPEAT-CONTAINING PROTEIN 35 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATCAGCATGCAACATTGTGTTCGGAAAG |
Internal bar code: | CAGTTTGTCCTGATAACCCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 751 |
LEAP-Seq percent confirming: | 99.3729 |
LEAP-Seq n confirming: | 2060 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCGAAGGTGGCAATAGAA |
Suggested primer 2: | CCATACCGCAAGCTATGGTT |