Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.254672 |
Chromosome: | chromosome 4 |
Location: | 3667986 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g228850 | (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATATAATTAGATATAATGACGCGACTTGC |
Internal bar code: | ATACATCCGCCTATACCTAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 418 |
LEAP-Seq percent confirming: | 99.4987 |
LEAP-Seq n confirming: | 1191 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGAGTCGGGAAGCTTGAG |
Suggested primer 2: | CATGTTTCACTGTGGGTTGC |