Insertion junction: LMJ.RY0402.254757_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.254757
Chromosome:chromosome_1
Location:7969612
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g068012 PPR5 Pentatrichopeptide repeat protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGGAAACCCCTGCAGAGCACCTGGCATGCG
Internal bar code:TCAGCCCGCCGGTGTTGTGGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:180
LEAP-Seq percent confirming:94.0639
LEAP-Seq n confirming:206
LEAP-Seq n nonconfirming:13
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:AGGCTATGCCAGTAAGGTCG
Suggested primer 2:GCATAGTGGGCAAAGGTGAT