Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.254984 |
Chromosome: | chromosome 4 |
Location: | 1268371 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g215000 | BKT,CBK1,BKT1 | Beta-carotene ketolase; (1 of 1) IPR000104//IPR005804 - Antifreeze protein, type I // Fatty acid desaturase domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGAAGGGTAGCTGGTAGTGGCGGTACA |
Internal bar code: | CTTTACGGGGCGGGCGGCGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 651 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTGTCTACGGGCTGTGGT |
Suggested primer 2: | AGTCGGTAGACAATCGTGGG |