| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.255023 |
| Chromosome: | chromosome 3 |
| Location: | 1770052 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154000 | ABCA1A,ABCA1 | (1 of 173) IPR029058 - Alpha/Beta hydrolase fold; ABC transporter 1 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACGTGCCAACCTTGGTGGCGCCAGCCT |
| Internal bar code: | GCGGGGTCTAGGTATGGGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 588 |
| LEAP-Seq percent confirming: | 98.1763 |
| LEAP-Seq n confirming: | 646 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATAGCGGGTTGATGAAGT |
| Suggested primer 2: | AAGACAGGGTTTTCGTGTGG |