| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.255134 |
| Chromosome: | chromosome 16 |
| Location: | 2848268 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663450 | LCI11B,BST3,LCI11 | Bestrophin 3; (1 of 10) PF01062 - Bestrophin, RFP-TM, chloride channel (Bestrophin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCGTGCGCGCCATCCACGCCATCAGCC |
| Internal bar code: | CTTCCGGGGCGGTCCCTAGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 391 |
| LEAP-Seq percent confirming: | 98.1481 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGACATGTTCCGTCAATG |
| Suggested primer 2: | CTGCCTAGACTCACCCGAAG |