Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.255134 |
Chromosome: | chromosome 16 |
Location: | 2848443 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g663450 | LCI11B,BST3,LCI11 | Bestrophin 3; (1 of 10) PF01062 - Bestrophin, RFP-TM, chloride channel (Bestrophin) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAATCACGTGGGACCTGTGGAACAAGAT |
Internal bar code: | GTAGTACTCTCCCCCCCATCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 129 |
LEAP-Seq percent confirming: | 99.1957 |
LEAP-Seq n confirming: | 370 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGACATGTTCCGTCAATG |
Suggested primer 2: | CTGCCTAGACTCACCCGAAG |