| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.255391 |
| Chromosome: | chromosome 16 |
| Location: | 1301982 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g651500 | (1 of 1) K12180 - COP9 signalosome complex subunit 7 (COPS7, CSN7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGTAGTGGCGGTCGCGGGGGAGTCGGTT |
| Internal bar code: | ATCGTTCCCGGCGTTCTGCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 490 |
| LEAP-Seq percent confirming: | 99.2711 |
| LEAP-Seq n confirming: | 681 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGTCAGTACGGTCTGTGG |
| Suggested primer 2: | CGGCTGCTAGCTCTCAAGTT |