Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.255418 |
Chromosome: | chromosome 9 |
Location: | 2771963 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389089 | CNX5,NOFNIR1,NOFNiR,ARC1 | NO-forming nitrite reductase; (1 of 1) PTHR14237:SF30 - MITOCHONDRIAL AMIDOXIME-REDUCING COMPONENT 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTGTCAGGTTGCCGCTTGCCGCGCATT |
Internal bar code: | AAGTGCGTCGGATCCCGCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 583 |
LEAP-Seq percent confirming: | 99.6678 |
LEAP-Seq n confirming: | 300 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGCTGCTAGTAAATCCGC |
Suggested primer 2: | TGACGCTTCCAAGCACATAG |