| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.255446 |
| Chromosome: | chromosome 9 |
| Location: | 4569657 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396252 | GSR2,GSHR2 | (1 of 2) 1.8.1.7 - Glutathione-disulfide reductase / NADPH:oxidized-glutathione oxidoreductase; Glutathione reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACCCAAGGGTGGGGTGCCTCCGTGGGGT |
| Internal bar code: | TGAATTGTAGAGTGATTTCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 908 |
| LEAP-Seq percent confirming: | 99.5921 |
| LEAP-Seq n confirming: | 3662 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTTTGTCCTGTGTGTTT |
| Suggested primer 2: | GTGGGGCAAAGTACGAGTGT |