| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.255687 |
| Chromosome: | chromosome 7 |
| Location: | 5092482 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g347700 | (1 of 1) PF10220 - Uncharacterized conserved protein (DUF2146) (DUF2146) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGCTCAAAGCTAAAAGGCGCCAACTGA |
| Internal bar code: | ATGCCCCTCCAGGCGAGTTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 88.3588 |
| LEAP-Seq n confirming: | 463 |
| LEAP-Seq n nonconfirming: | 61 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAACAGGTAGCAAGCC |
| Suggested primer 2: | CCCTCAACTTGGAAACAAGC |