| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.255699 |
| Chromosome: | chromosome 3 |
| Location: | 5102437 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g181450 | TCTN1,POB7 | (1 of 1) K19382 - tectonic-1/3 (TCTN1_3); Proteome of basal body 7 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGTAGAGTCGTCGCACACTGTGGCCGT |
| Internal bar code: | CGATGGTGTCCGAAACCTGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 594 |
| LEAP-Seq percent confirming: | 92.9577 |
| LEAP-Seq n confirming: | 264 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATGCTGCTTTACAGTGA |
| Suggested primer 2: | GGGGGAGTAGTACATGGGGT |