| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.255743 |
| Chromosome: | chromosome 1 |
| Location: | 4898219 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g033950 | EXN2 | 3'-5' exonuclease with GRF zinc finger domain; (1 of 1) K18417 - ERI1 exoribonuclease 2 [EC:3.1.-.-] (ERI2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCATCCTGCCGCCGACAACGCGGTGGGG |
| Internal bar code: | CGGTCACATGTGTCGTTTCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 555 |
| LEAP-Seq percent confirming: | 95.202 |
| LEAP-Seq n confirming: | 377 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTCTACACAGCTCATCCG |
| Suggested primer 2: | CGGCACCAAAGACCTGTAAT |