Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.255875 |
Chromosome: | chromosome 12 |
Location: | 696722 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g494800 | DII1,IDA-IC28,IDA4,p28IDA4 | (1 of 1) K10410 - dynein light intermediate chain, axonemal (DNALI); Flagellar inner arm dynein light chain p28 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAATTCAATCTGGACATAGGGAATGGA |
Internal bar code: | TTACTGCGTCCTTGTGTGACGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 282 |
LEAP-Seq percent confirming: | 99.4766 |
LEAP-Seq n confirming: | 4561 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGATAAGCAAATCGACGAA |
Suggested primer 2: | GCGTAGGAGCGCTGTAATTC |