Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.255999 |
Chromosome: | chromosome 10 |
Location: | 2745710 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g438500 | CPK3,MOT54,FAP264 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype; Flagellar Associated Protein 264 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCGAGGAGGACCAATTCGGGCGCATGC |
Internal bar code: | TGATCCTAGCTTCGGCCCCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 857 |
LEAP-Seq percent confirming: | 96.7742 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGTTCTGTCCAGGGATGG |
Suggested primer 2: | GGAAGCTCTTCACGGTCTTG |