| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.256170 |
| Chromosome: | chromosome 14 |
| Location: | 1852744 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620400 | SPC22 | Signal Peptidase, 22 kDa catalytic subunit; (1 of 1) K12948 - signal peptidase complex subunit 3 (SPCS3, SPC3) | gene_edge/mRNA_edge/5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGAGTCTCAAGGGCAGTATATTTATTT |
| Internal bar code: | GGACGCGAGTGGTCGAATTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 617 |
| LEAP-Seq percent confirming: | 96.0915 |
| LEAP-Seq n confirming: | 1008 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTGCTGCACAATGGAGTC |
| Suggested primer 2: | ATACCACTCCAAGCGGACAC |