| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.256186 |
| Chromosome: | chromosome 6 |
| Location: | 5770687 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g287400 | STPK23,STK23 | Serine/threonine protein kinase; (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCCCATCCTTTGGTCCAGTCAGGCGCC |
| Internal bar code: | TGGGGTCATGTGCGTAATTTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 115 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGGATGTTTCGTTTTGT |
| Suggested primer 2: | GTGGTGCTGAATGTTGTTGG |