| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.256192 |
| Chromosome: | chromosome 2 |
| Location: | 2541508 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092550 | TPR1 | (1 of 1) 6.2.1.4 - Succinate--CoA ligase (GDP-forming) / Succinyl-CoA synthetase (GDP-forming); Tetratricopeptide-repeat protein 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCAGGCGCGCGCCAGGTCTGCTGCCTCC |
| Internal bar code: | TGCGGCTCCGCGGACTCGGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1052 |
| LEAP-Seq percent confirming: | 98.6425 |
| LEAP-Seq n confirming: | 218 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGTGTCTCGTCACTTTCG |
| Suggested primer 2: | ATGCCCTTCATCATCTCCTG |