Insertion junction: LMJ.RY0402.256192_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.256192
Chromosome:chromosome_6
Location:7926173
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g303400 FAP16 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGTATGCGTGTTGACAAGGAAACAGCGAAT
Internal bar code:AGGACTGGCGGCCAGCAAAACT

Confirmation - LEAP-Seq

LEAP-Seq distance:290
LEAP-Seq percent confirming:98.2659
LEAP-Seq n confirming:170
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:AGCGCGAGAACCGTAAGATA
Suggested primer 2:CTGGATAAGCACTAAGCCGC